SubtiBank SubtiBank
thrD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thrD

aspartokinase III
locus
BSU03790
pI
4.78
mw
49.66 kDa
protein length
454 aa Sequence Blast
gene length
1365 bp Sequence Blast
function
unknown
product
aspartokinase III
essential
no
ec
2.7.2.4
synonyms
yclM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    Coordinates
    430,623 431,987

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-aspartate = ADP + 4-phospho-L-aspartate (according to Swiss-Prot)
  • Protein family

  • aspartokinase family (with [protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|DapG] and [protein|F7B947938FB40E54D89A719E9610C5A4AA400674|LysC], according to UniProt)
  • [SW|Domains]

  • [SW|ACT domain] (aa 389 ... 454) (according to the Interpro database)
  • Effectors of protein activity

  • inhibited by the simultaneous presence of threonine and lysine [Pubmed|11471740]
  • Structure

  • [PDB|3TVI] (from Clostridium acetobutylicum, 37% identity) [pubmed|25170437]
  • Expression and Regulation

    Operons

    genes
    [gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C009 (yclM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2007 NBRP B. subtilis, Japan]
  • BKE03790 ([gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACATCTCCTAATG, downstream forward: _UP4_TAATCGTACATAAATAGCGG
  • BKK03790 ([gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACATCTCCTAATG, downstream forward: _UP4_TAATCGTACATAAATAGCGG
  • lacZ fusion

  • pBP318 (in [SW|pAC5]), available in [SW|Fabian Commichau]'s lab [Pubmed|27260660]
  • References

    Reviews

  • 19946135,22079167
  • Original publications

  • 11471740,23569278,2152900,2153658,22383849,27260660,25170437