SubtiBank SubtiBank
yacD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yacD

putative peptidyl-prolyl cis-trans isomerase, similar to secretion protein [protein|6EE13E61A218A6D52BAC83A1145B0B96961CE289|PrsA]
locus
BSU_00720
pI
4.95
mw
33.94 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.6|Protein secretion/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    80,802 81,695

    The protein

    Catalyzed reaction/ biological activity

  • [protein]-peptidylproline (ω=180) --> [protein]-peptidylproline (ω=0) (according to UniProt)
  • peptidyl-prolyl cis-trans isomerase activity (according to UniProt)
  • [SW|Domains]

  • PpiC domain (aa 154-247) (according to UniProt)
  • Structure

  • [PDB|5EZ1] (from Helicobacter pylori, 26% identity) [pubmed|26850168]
  • [SW|Localization]

  • extracellular (with signal peptide) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]-[gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]-[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B925 (yacD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1924 NBRP B. subtilis, Japan]
  • BKE00720 ([gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCTGCTTTCAGCCCCT, downstream forward: _UP4_TGATTGACAAAAAATTTTGA
  • BKK00720 ([gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCTGCTTTCAGCCCCT, downstream forward: _UP4_TGATTGACAAAAAATTTTGA