SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glycine betaine and arsenobetaine [SW|ABC transporter] (binding protein)
32.06 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
compatible solute transport
glycine betaine and arsenobetaine [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    323,119 324,000

    The protein

    Catalyzed reaction/ biological activity

  • binding for subsequent uptake of glycine betaine and arsenobetaine [pubmed|29159878,24561588]
  • binding for subsequent uptake of dimethylglycine [Pubmed|24561588]
  • Structure

  • [PDB|2B4L] (complex with glycine betaine)
  • [PDB|3CHG] (in complex with DMSA)
  • [PDB|5NXX] (in complex with arsenobetaine) [pubmed|29159878]
  • [SW|Localization]

  • associated to the membrane (via [protein|5F989C57010ACFC03E37AF5A894153F432520921|OpuAB]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23175650], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • regulation

  • induced by osmotic stress [Pubmed|23175650]
  • view in new tab

    Biological materials


  • BKE03000 ([gene|546407EFD8128D1F74443991B8D600F668FBD7A1|opuAC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCCTATGATTTTTTTAA, downstream forward: _UP4_TAATCAAAAAAGCAGCCTGT
  • BKK03000 ([gene|546407EFD8128D1F74443991B8D600F668FBD7A1|opuAC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCCTATGATTTTTTTAA, downstream forward: _UP4_TAATCAAAAAAGCAGCCTGT
  • Expression vectors

  • pGP2926 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 27935846
  • Original publications

  • 10092453,9335265,16645306,16225868,16445940,7622480,18567662,21296969,22383849,23175650,23646920,24561588,25012968,29159878