SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyrroline-5-carboxylate reductase
31.88 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
osmoadaptive de novo production of proline
pyrroline-5-carboxylate reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of proline]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    2,016,845 2,017,738

    The protein

    Catalyzed reaction/ biological activity

  • 1-pyrroline-5-carboxylate + NAD(P)H + H+ --> L-proline + NAD(P)+ [pubmed|28824574]
  • Protein family

  • [SW|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
  • Paralogous protein(s)

  • [protein|93000B579F630E9F0C6EED40D6661E5E15141FDE|ProI]
  • [SW|Cofactors]

  • NADPH [pubmed|28824574]
  • Effectors of protein activity

  • feedback-inhibited by proline [pubmed|28824574]
  • Structure

  • [PDB|5BSE] (from ''Medicago truncatula'', 36% identity) [pubmed|26579138]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21784929], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • expressed under conditions of osmotic stress [Pubmed|21784929]
  • view in new tab

    Biological materials


  • MGNA-B083 (proH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18480 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCACACGTTTAAAAT, downstream forward: _UP4_GCGCCGCTATCAGGAGTGAT
  • BKK18480 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCACACGTTTAAAAT, downstream forward: _UP4_GCGCCGCTATCAGGAGTGAT
  • References


  • 25367752
  • Original publications

  • 11418582,21296969,25344233,21784929,27766092,28752945,28824574,26579138