SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component orphan sensor kinase
31.62 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
two-component orphan sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,742,384 3,743,220

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A529 (ywpD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36350 ([gene|53EF65638E0001CA3679EA96A63C864F5F599B65|ywpD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGACTTCGAAACCAG, downstream forward: _UP4_TAAACGAAAATTGAGATAAA
  • BKK36350 ([gene|53EF65638E0001CA3679EA96A63C864F5F599B65|ywpD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGACTTCGAAACCAG, downstream forward: _UP4_TAAACGAAAATTGAGATAAA
  • References

  • 10094672