SubtiBank SubtiBank
lytT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytT

two-component response regulator, control of pyruvate utilization
locus
BSU28920
pI
5.08
mw
27.68 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
control of pyruvate utilization
product
two-component response regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    2,955,783 2,956,508

    The protein

    Modification

  • phosphorylated on Asp by [protein|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|LytS]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]-[gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A014 (lytT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/14 NBRP B. subtilis, Japan]
  • BKE28920 ([gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCATCCCTTGCCAGCATCT, downstream forward: _UP4_TGATGGGCGGCTTTTTGCAT
  • BKK28920 ([gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCATCCCTTGCCAGCATCT, downstream forward: _UP4_TGATGGGCGGCTTTTTGCAT
  • References

    Reviews

  • 29208748,29354650
  • Original publications

  • 10094672,8969504,27422364,28974613