SubtiBank SubtiBank
lytT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lytT

two-component response regulator, control of pyruvate utilization
locus
BSU_28920
pI
5.08
mw
27.68 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
control of pyruvate utilization
product
two-component response regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    2,955,783 2,956,508

    The protein

    [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-117) (according to UniProt)
  • HTH LyTR-type domain (aa 137-241) (according to UniProt)
  • Modification

  • phosphorylated on Asp by [protein|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|LytS]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]-[gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A014 (lytT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/14 NBRP B. subtilis, Japan]
  • BKE28920 ([gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCATCCCTTGCCAGCATCT, downstream forward: _UP4_TGATGGGCGGCTTTTTGCAT
  • BKK28920 ([gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCATCCCTTGCCAGCATCT, downstream forward: _UP4_TGATGGGCGGCTTTTTGCAT
  • References

    Reviews

  • 29208748,29354650
  • Original publications

  • 10094672,8969504,27422364,28974613