SubtiBank SubtiBank
defB

defB

N-formylcysteine deformylase, required for the conversion of S-methyl-cysteine to cysteine
locus
BSU_14560
pI
5.46
mw
20.51 kDa
protein length
184 aa Sequence Blast
gene length
555 bp Sequence Blast
function
utilization of S-methyl-cysteine
product
N-formylcysteine deformylase
essential
no
ec
3.5.1.88
synonyms
ykrB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.1|Conversion of S-methyl cysteine to cysteine]
  • Gene

    Coordinates
    1,526,195 1,526,749

    Phenotypes of a mutant

  • a ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant is not viable unless the cells acquire suppressor mutations in ''[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt], [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]'' or ''[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]'' [Pubmed|27983482]
  • no growth with S-methyl cysteine [Pubmed|23944997]
  • inactivation of ''[gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' reduces sporulation efficiency to 9% that of wild type cells; engulfment and fission defects, with reduced [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activity [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetylcysteine - cysteine + acetate [Pubmed|23944997]
  • H2O + N-terminal N-formyl-L-methionyl-[peptide] --> formate + N-terminal L-methionyl-[peptide] (according to UniProt)
  • Protein family

  • polypeptide deformylase family (with [protein|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|DefA], according to UniProt)
  • Paralogous protein(s)

  • [protein|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|DefA]
  • Structure

  • [PDB|1LQY] (complex with antibiotic actinonin, Geobacillus stearothermophilus, 67% identity) [pubmed|12126617]
  • Expression and Regulation

    Operons

    genes
    [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A901 (ykrB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/901 NBRP B. subtilis, Japan]
  • BKE14560 ([gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAACTTCACTCCTAAA, downstream forward: _UP4_TAAAAGAGAAAACGGCTGGC
  • BKK14560 ([gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAACTTCACTCCTAAA, downstream forward: _UP4_TAAAAGAGAAAACGGCTGGC
  • References

  • 11429456,23944997,26735940,27983482,12126617