SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


uric acid permease
46.94 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
purine utilization
uric acid permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,330,502 3,331,851

    The protein

    Protein family

  • xanthine/uracil permease family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|PbuX], [protein|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|PucK]
  • Structure

  • [PDB|3QE7] (E. coli uracil transporter, 31% identity) [pubmed|21423164]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab


    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A935 (yunJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32430 ([gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATAGTCCCTCCCTGTA, downstream forward: _UP4_TTAGAAAAAGAGGTGTAAAA
  • BKK32430 ([gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATAGTCCCTCCCTGTA, downstream forward: _UP4_TTAGAAAAAGAGGTGTAAAA
  • References

  • 11344136,12823818,12029039,25755103,21423164