SubtiBank SubtiBank
yjcA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcA

unknown
locus
BSU_11790
pI
4.81
mw
12.90 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,252,177 1,252,533

    The protein

    Protein family

  • UPF0713 family (with [protein|A5238B160277C6440977DE099D3414E2A83ACD81|YngL], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]
    description
    [Pubmed|14523132]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523132,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell [Pubmed|14523132,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B294 (yjcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1293 NBRP B. subtilis, Japan]
  • BKE11790 ([gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCGTTCACTCCTTTGCC, downstream forward: _UP4_TAAGGCGTTACCACCAGCAA
  • BKK11790 ([gene|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCGTTCACTCCTTTGCC, downstream forward: _UP4_TAAGGCGTTACCACCAGCAA
  • References

  • 14523132,15699190