SubtiBank SubtiBank
cotJB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotJB

polypeptide composition of the spore coat
locus
BSU_06900
pI
5.70
mw
11.61 kDa
protein length
gene length
264 bp Sequence Blast
function
polypeptide composition of the spore coat
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    756,139 756,402

    Expression and Regulation

    Operons

    genes
    [gene|65A8D8D94E8E48DA28BA1F7BBB2FDBEB56A5EC72|cotJA]-[gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]-[gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]-[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]-[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]
    description
    [Pubmed|7768848]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7768848,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7768848], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|7768848]
  • view in new tab

    Biological materials

    Mutant

  • BKE06900 ([gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCTAGCTGACGATAATATT, downstream forward: _UP4_CAAGTATAAGGAGGAATGCC
  • BKK06900 ([gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCTAGCTGACGATAATATT, downstream forward: _UP4_CAAGTATAAGGAGGAATGCC
  • References

    Reviews

  • 27227299
  • Original publications

  • 9364920,7768848