SubtiBank SubtiBank
rsbQ [2020-10-13 17:31:35]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rsbQ [2020-10-13 17:31:35]

alpha/beta hydrolase, required for [protein|9284E58A2D5394A31658E70879874A1338CF531B|RsbP] activation
29.87 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
alpha/beta hydrolase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • Gene

    3,499,541 3,500,350

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 23-259) (according to InterPro)
  • Structure

  • [PDB|1WOM] [Pubmed|15632289]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A480 (yvfQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34100 ([gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGGCTCCTTTCAGC, downstream forward: _UP4_TGATATAGGAACGAAAGGGA
  • BKK34100 ([gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGGCTCCTTTCAGC, downstream forward: _UP4_TGATATAGGAACGAAAGGGA
  • labs

  • [SW|Chet Price], Davis, USA [ homepage]
  • References

  • 15632289,11591687,19432806,27977677,32075967