SubtiBank SubtiBank
rsbQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsbQ

alpha/beta hydrolase, required for [protein|9284E58A2D5394A31658E70879874A1338CF531B|RsbP] activation
locus
BSU34100
pI
5.00
mw
29.87 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
product
alpha/beta hydrolase
essential
no
synonyms
yvfQ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    3,499,541 3,500,350

    The protein

    Protein family

  • AB hydrolase superfamily (according to Swiss-Prot)
  • Structure

  • [PDB|1WOM] [Pubmed|15632289]
  • Expression and Regulation

    Operons

    genes
    [gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]-[gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A480 (yvfQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/480 NBRP B. subtilis, Japan]
  • BKE34100 ([gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGGCTCCTTTCAGC, downstream forward: _UP4_TGATATAGGAACGAAAGGGA
  • BKK34100 ([gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGGCTCCTTTCAGC, downstream forward: _UP4_TGATATAGGAACGAAAGGGA
  • labs

  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

  • 15632289,11591687,19432806,27977677