SubtiBank SubtiBank
gltT [2017-10-25 13:07:01]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltT [2017-10-25 13:07:01]

major high-affinity Na+-coupled glutamate/ aspartate symport protein
45.76 kDa
protein length
429 aa Sequence Blast
gene length
1287 bp Sequence Blast
glutamate and aspartate uptake
major Na+-coupled glutamate/ aspartate symport protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,096,560 → 1,097,849

    Phenotypes of a mutant

  • impaired uptake of glutamate and aspartate [Pubmed|25344233]
  • The protein

    Protein family

  • View classification (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|622856EE642C42247C658DBD57E6A18C6E81FE58|GltP], [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|DctP]
  • Structure

  • [PDB|4IZM] (the protein from ''Pyrococcus horikoshii'', 35% identity, 73% similarity) [Pubmed|23563139]
  • [ 4KY0] (the glutamate transporter of ''Thermococcus kodakarensis'', 35% identity, 72% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2247 (''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2248 (''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • available in [SW|Erhard Bremer]'s lab [Pubmed|25344233]
  • BKE10220 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
  • BKK10220 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
  • References

  • 18763711,23563139,22383849,24013209,25344233