SubtiBank SubtiBank
gltT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltT

major high-affinity Na+-coupled glutamate/ aspartate symport protein, uptake of glyphosate
locus
BSU10220
pI
9.03
mw
45.76 kDa
protein length
429 aa Sequence Blast
gene length
1290 bp Sequence Blast
function
glutamate and aspartate uptake
product
major Na+-coupled glutamate/ aspartate symport protein
essential
no
synonyms
yhfG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,096,560 1,097,849

    Phenotypes of a mutant

  • impaired uptake of glutamate and aspartate [Pubmed|25344233]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of glutamate and aspartate
  • uptake of glyphosate and glufosinate [pubmed|30666812]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|622856EE642C42247C658DBD57E6A18C6E81FE58|GltP], [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|DctP]
  • Kinetic information

  • Km values: 37 5 M for glutamate, 41 9 M for aspartate [pubmed|25344233]
  • Effectors of protein activity

  • aspartate uptake is competitively inhibited by glutamate [pubmed|29995990]
  • Structure

  • [PDB|4IZM] (the protein from ''Pyrococcus horikoshii'', 35% identity, 73% similarity) [Pubmed|23563139]
  • [http://pdb.org/pdb/explore/explore.do?structureId=4KY0 4KY0] (the glutamate transporter of ''Thermococcus kodakarensis'', 35% identity, 72% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BP233 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''spc''), available in [SW|Fabian Commichau]'s lab
  • BP235 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''spc '' Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::''cat''), available in [SW|Fabian Commichau]'s lab
  • GP2247 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2248 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP2722 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''zeo''), available in [SW|Jörg Stülke]'s lab
  • BKE10220 ([gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
  • BKK10220 ([gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
  • GP2831 (''Δ''''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3'' ''Δ''''[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP3063 ''gltT-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • for expression in ''B. subtilis'', in [SW|pAC7]: pBP56, available in [SW|Fabian Commichau]'s lab
  • References

  • 18763711,23563139,22383849,24013209,25344233,14596613,10588697,29995990,30666812