SubtiBank SubtiBank
yozJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozJ

unknown
locus
BSU_18900
pI
4.13
mw
17.70 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,060,237 2,060,692

    The protein

    Protein family

  • UPF0361 family
  • Biological materials

    Mutant

  • MGNA-B408 (yozJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1407 NBRP B. subtilis, Japan]
  • BKE18900 ([gene|533C6FC630F1406B17508223352C6536284DBADD|yozJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCCTCCTAATTTA, downstream forward: _UP4_TTAAGTCTAAATAAAAGATA
  • BKK18900 ([gene|533C6FC630F1406B17508223352C6536284DBADD|yozJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCCTCCTAATTTA, downstream forward: _UP4_TTAAGTCTAAATAAAAGATA