SubtiBank SubtiBank
ispA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ispA

intracellular serine protease
locus
BSU_13190
pI
4.52
mw
33.69 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
protein degradation
product
intracellular serine protease
essential
no
synonyms
ispI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    1,386,024 1,386,983

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Peptidase S8 domain] (aa 23-307) (according to UniProt)
  • Structure

  • [PDB|2WV7] (from Bacillus clausii, 53% identity) [pubmed|20541512]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|53364B1E6728EA385E95F96E47AFDE6D65AD7040|ispA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3087947], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|23569278]
  • view in new tab

    Biological materials

    Mutant

  • BKE13190 ([gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGCCCTCCTTTT, downstream forward: _UP4_TAAGATTATTTTTCTTATAT
  • BKK13190 ([gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGCCCTCCTTTT, downstream forward: _UP4_TAAGATTATTTTTCTTATAT
  • References

  • 3087947,23569278,20541512