SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


intracellular serine protease
33.69 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
protein degradation
intracellular serine protease

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    1,386,024 1,386,983

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Peptidase S8 domain] (aa 23-307) (according to UniProt)
  • Structure

  • [PDB|2WV7] (from Bacillus clausii, 53% identity) [pubmed|20541512]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3087947], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|23569278]
  • view in new tab

    Biological materials


  • BKE13190 ([gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGCCCTCCTTTT, downstream forward: _UP4_TAAGATTATTTTTCTTATAT
  • BKK13190 ([gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGCCCTCCTTTT, downstream forward: _UP4_TAAGATTATTTTTCTTATAT
  • References

  • 3087947,23569278,20541512