SubtiBank SubtiBank
ytnP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytnP

lactonase-homolog protein, inhibits the signalling pathway required for the streptomycin production and development of aerial mycelium in Streptomyces griseus
locus
BSU29890
pI
5.93
mw
29.02 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
defense against competing bacteria
product
lactonase-homolog protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,058,631 3,059,401

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Modification

  • phosphorylation on Ser-36 [Pubmed|17218307]
  • Structure

  • [PDB|3ESH] (from Staphylococcus aureus, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]-[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A511 (ytnP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/511 NBRP B. subtilis, Japan]
  • BKE29890 ([gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCTCCGTCCATAT, downstream forward: _UP4_TAGCATATTTTTATGTTTAC
  • BKK29890 ([gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCTCCGTCCATAT, downstream forward: _UP4_TAGCATATTTTTATGTTTAC
  • References

  • 17218307,22101040