SubtiBank SubtiBank
ytnP

ytnP

lactonase-homolog protein, inhibits the signalling pathway required for the streptomycin production and development of aerial mycelium in Streptomyces griseus
locus
BSU_29890
pI
5.93
mw
29.02 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
defense against competing bacteria
product
lactonase-homolog protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,058,631 3,059,401

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Modification

  • phosphorylation on Ser-36 [Pubmed|17218307]
  • Structure

  • [PDB|3ESH] (from Staphylococcus aureus, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]-[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A511 (ytnP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/511 NBRP B. subtilis, Japan]
  • BKE29890 ([gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCTCCGTCCATAT, downstream forward: _UP4_TAGCATATTTTTATGTTTAC
  • BKK29890 ([gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCTCCGTCCATAT, downstream forward: _UP4_TAGCATATTTTTATGTTTAC
  • References

  • 17218307,22101040