SubtiBank SubtiBank
sacX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sacX

sucrose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY] activity
locus
BSU_38410
pI
9.35
mw
48.86 kDa
protein length
459 aa Sequence Blast
gene length
1380 bp Sequence Blast
function
sucrose uptake and phosphorylation, control of [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY] activity
product
sucrose-specific [category|SW 1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
ipa-14r,sacS

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    Coordinates
    3,942,234 3,943,613

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP], [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|TreP], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|MurP]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]
    description
    [Pubmed|2116367]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1400159], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|1400159], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • induction by sucrose (at high concentration) [Pubmed|8535520]
  • view in new tab

    Biological materials

    Mutant

  • BKE38410 ([gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCAATTAAAACCTCCTT, downstream forward: _UP4_TAACTGGATTTATTCGATTT
  • BKK38410 ([gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCAATTAAAACCTCCTT, downstream forward: _UP4_TAACTGGATTTATTCGATTT
  • References

  • 10627040,2105292,2116367,1400159,8535520,30038046