SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


31.34 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    754,920 755,780

    The protein

    Protein family

  • NmrA-type oxidoreductase family (single member, according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A955 (yesF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06880 ([gene|530BECBA14BDB4854CDADE894EE590EA8008EBAE|yesF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATCGGATTCTGTT, downstream forward: _UP4_TAGTCTAGAAAGACCTTCGG
  • BKK06880 ([gene|530BECBA14BDB4854CDADE894EE590EA8008EBAE|yesF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATCGGATTCTGTT, downstream forward: _UP4_TAGTCTAGAAAGACCTTCGG
  • References

  • 7768848