SubtiBank SubtiBank
yesF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesF

unknown
locus
BSU_06880
pI
8.97
mw
31.34 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yeeM,yfxB

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    754,920 755,780

    The protein

    Protein family

  • NmrA-type oxidoreductase family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|84E299B86EE59C7B373E0BB11E7D9C80F03828B9|yesE]-[gene|530BECBA14BDB4854CDADE894EE590EA8008EBAE|yesF]
    description
    [Pubmed|7768848]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A955 (yesF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/955 NBRP B. subtilis, Japan]
  • BKE06880 ([gene|530BECBA14BDB4854CDADE894EE590EA8008EBAE|yesF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATCGGATTCTGTT, downstream forward: _UP4_TAGTCTAGAAAGACCTTCGG
  • BKK06880 ([gene|530BECBA14BDB4854CDADE894EE590EA8008EBAE|yesF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATCGGATTCTGTT, downstream forward: _UP4_TAGTCTAGAAAGACCTTCGG
  • References

  • 7768848