SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


5.76 kDa
protein length
gene length
159 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,660,574 2,660,732

    Biological materials


  • BKE25850 ([gene|52C4FC8F59B5A09EFF934E44CC8277714CC3751A|yqzI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATGTTCACCTCAAAAG, downstream forward: _UP4_TAGATTACGAGGAAGAGATT
  • BKK25850 ([gene|52C4FC8F59B5A09EFF934E44CC8277714CC3751A|yqzI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATGTTCACCTCAAAAG, downstream forward: _UP4_TAGATTACGAGGAAGAGATT
  • References

  • 27766092