SubtiBank SubtiBank
yqzI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqzI

unknown
locus
BSU25850
pI
4.32
mw
5.76 kDa
protein length
gene length
159 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,660,574 2,660,732

    Biological materials

    Mutant

  • BKE25850 ([gene|52C4FC8F59B5A09EFF934E44CC8277714CC3751A|yqzI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATGTTCACCTCAAAAG, downstream forward: _UP4_TAGATTACGAGGAAGAGATT
  • BKK25850 ([gene|52C4FC8F59B5A09EFF934E44CC8277714CC3751A|yqzI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATGTTCACCTCAAAAG, downstream forward: _UP4_TAGATTACGAGGAAGAGATT
  • References

  • 27766092