SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional regulator of puc genes
60.34 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
regulation of purine utilization
transcriptional regulator of puc genes ([SW|PucR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,328,762 3,330,357

    The protein

    Protein family

  • [SW|PucR family]
  • [SW|CdaR family] (according to UniProt)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A934 (yunI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32420 ([gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
  • BKK32420 ([gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
  • References

  • 12374841,11344136,12029039,12823818,25755103