SubtiBank SubtiBank
pucR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucR

transcriptional regulator of puc genes
locus
BSU32420
pI
6.19
mw
60.34 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
function
regulation of purine utilization
product
transcriptional regulator of puc genes ([SW|PucR family])
essential
no
synonyms
yunI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,328,762 3,330,357

    The protein

    Protein family

  • [SW|PucR family]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000058 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]-[gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A934 (yunI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/934 NBRP B. subtilis, Japan]
  • BKE32420 ([gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
  • BKK32420 ([gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
  • References

  • 12374841,11344136,12029039,12823818,25755103