SubtiBank SubtiBank
yclK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yclK

two-component sensor kinase
locus
BSU_03760
pI
6.15
mw
54.88 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
unknown
product
two-component sensor kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    427,247 428,668

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH], [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|KinE], [protein|4EE48E4931F662E51586DB6D01E91C688329222D|CssS]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|HAMP domain] (aa 187-239) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 254-470) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]-[gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]
    description
    [Pubmed|15375128]

    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|15375128], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|15375128]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C008 (yclK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2006 NBRP B. subtilis, Japan]
  • BKE03760 ([gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTAGCAGCAGCTGATATA, downstream forward: _UP4_TAGCATACAGGGCGGCGCAT
  • BKK03760 ([gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTAGCAGCAGCTGATATA, downstream forward: _UP4_TAGCATACAGGGCGGCGCAT
  • References

  • 10094672,15375128