SubtiBank SubtiBank
mtlA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtlA

mannitol-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICB of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR] activity
locus
BSU03981
pI
8.81
mw
50.00 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
function
mannitol uptake and phosphorylation, control of [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR] activity
product
mannitol-specific [category|SW 1.2.2|PTS], EIICB
essential
no
ec
2.7.1.69
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.10|Utilization of mannitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    449,724 451,160

    The protein

    Catalyzed reaction/ biological activity

  • Protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine/cysteine (according to Swiss-Prot)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
  • Modification

  • phosphorylation on Ser-559 [Pubmed|17218307]
  • Structure

  • [PDB|1A3A] (from ''Escherichia coli k12 mutant'', 42% identity, 66% similarity) [Pubmed|9551558]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]
    description
    [Pubmed|12897001]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]: activation, [Pubmed|20444094], in [regulon|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR regulon]
  • regulation

  • induced by mannitol ([protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]) [Pubmed|20444094]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C018 (mtlA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2016 NBRP B. subtilis, Japan]
  • BKE03981 ([gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03981 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACCCTCCCTGT, downstream forward: _UP4_TAATCTTATAGAAAGAGAGT
  • BKK03981 ([gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03981 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACCCTCCCTGT, downstream forward: _UP4_TAATCTTATAGAAAGAGAGT
  • References

    Reviews

  • 23318733
  • Original publications

  • 12897001,20444094,10627040,17218307,23279188,22014119