SubtiBank SubtiBank
skfG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

skfG

unknown
locus
BSU_01970
pI
5.19
mw
14.34 kDa
protein length
171 aa Sequence Blast
gene length
516 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ybdD

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    219,087 219,602

    Expression and Regulation

    Operons

    genes
    [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]
    description
    [Pubmed|16816204]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|search|skfA]'-specific transcript, and a weaker 6.5 kb '[protein|search|skfA]-[protein|search|skfB]-[protein|search|skfC]-[protein|search|skfE]-[protein|search|skfF]-[protein|search|skfG]-[protein|search|skfH]' transcript.
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C517 (ybdD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2515 NBRP B. subtilis, Japan]
  • BKE01970 ([gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGAGCCCCTCTCCT, downstream forward: _UP4_CTGAAAGATAAGGAGGACTG
  • BKK01970 ([gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGAGCCCCTCTCCT, downstream forward: _UP4_CTGAAAGATAAGGAGGACTG
  • References

    Reviews

  • 20955377
  • Original Publications

  • 14651647,12817086,15687200,17720793,16816204