SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


12.02 kDa
protein length
gene length
276 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,319,286 3,319,561

    The protein


  • [PDB|2KL5]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-A976 (yutD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32310 ([gene|527956DFAF0BE1115E6FDC82B03527D0BA96D56F|yutD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCACCTCTTTTTT, downstream forward: _UP4_TAAATATACACAAAGGGGAT
  • BKK32310 ([gene|527956DFAF0BE1115E6FDC82B03527D0BA96D56F|yutD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCACCTCTTTTTT, downstream forward: _UP4_TAAATATACACAAAGGGGAT
  • References

  • 27907199