SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to arsenate reductase
13.77 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.12|Resistance against toxic metals/ based on similarity]
  • Gene

    3,366,573 3,366,929

    The protein

    Protein family

  • ArsC family (with [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] and [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx], according to UniProt)
  • Structure

  • [PDB|2M46] (from Staphylococcus aureus, 51% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B593 (yusI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA, downstream forward: _UP4_TAATGTAAATTTTTTTTGAA
  • BKK32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA, downstream forward: _UP4_TAATGTAAATTTTTTTTGAA