SubtiBank SubtiBank
yusI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yusI

similar to arsenate reductase
locus
BSU_32810
pI
5.59
mw
13.77 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.12|Resistance against toxic metals/ based on similarity]
  • Gene

    Coordinates
    3,366,573 3,366,929

    The protein

    Protein family

  • ArsC family (with [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] and [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx], according to UniProt)
  • Structure

  • [PDB|2M46] (from Staphylococcus aureus, 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]-[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B593 (yusI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1592 NBRP B. subtilis, Japan]
  • BKE32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA, downstream forward: _UP4_TAATGTAAATTTTTTTTGAA
  • BKK32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA, downstream forward: _UP4_TAATGTAAATTTTTTTTGAA