SubtiBank SubtiBank
ywzG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywzG

similar to transcription factor
locus
BSU_38018
pI
8.80
mw
13.00 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,900,481 3,900,819

    The protein

    Structure

  • [PDB|5DYM] (from Clostridium difficile, 39% identity) [pubmed|27716049]
  • Biological materials

    Mutant

  • BKE38018 ([gene|52424B4904FC22186F75D6520D5E6BED7D815B96|ywzG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38018 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAACCCCTACCTA, downstream forward: _UP4_CAAAATGGATAAAGAAACAT
  • BKK38018 ([gene|52424B4904FC22186F75D6520D5E6BED7D815B96|ywzG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38018 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAACCCCTACCTA, downstream forward: _UP4_CAAAATGGATAAAGAAACAT
  • References

    Research papers

  • 27716049