SubtiBank SubtiBank
murAB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

murAB

UDP-N-acetylglucosamine 1-carboxyvinyltransferase
locus
BSU_37100
pI
5.83
mw
45.85 kDa
protein length
429 aa Sequence Blast
gene length
1290 bp Sequence Blast
function
peptidoglycan precursor biosynthesis
product
UDP-N-acetylglucosamine 1-carboxyvinyltransferase
essential
no
ec
2.5.1.7
synonyms
murZ,lssF,rev-4

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • Gene

    Coordinates
    3,806,086 3,807,375

    The protein

    Catalyzed reaction/ biological activity

  • phosphoenolpyruvate + UDP-N-acetyl-α-D-glucosamine --> phosphate + UDP-N-acetyl-3-O-(1-carboxyvinyl)-α-D-glucosamine(according to UniProt)
  • Protein family

  • EPSP synthase family (with [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|MurAA] and [protein|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|AroE], according to UniProt)
  • Paralogous protein(s)

  • [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|MurAA]
  • Structure

  • [PDB|3SG1] (from ''B. anthracis'', 50% identity, 81% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|523B01B5E7141C7DFC28CE67EB92580F49C20844|murAB]-[gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]
    description
    [Pubmed|19270101]

    regulation

  • constitutive [Pubmed|19270101]
  • view in new tab

    Biological materials

    Mutant

  • BKE37100 ([gene|523B01B5E7141C7DFC28CE67EB92580F49C20844|murAB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGTCTCCTTCCATA, downstream forward: _UP4_TAATGGTTTCTTGTGAGAGG
  • BKK37100 ([gene|523B01B5E7141C7DFC28CE67EB92580F49C20844|murAB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGTCTCCTTCCATA, downstream forward: _UP4_TAATGGTTTCTTGTGAGAGG
  • Expression vectors

  • pGP2595: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 21822642
  • Original publications

  • 19270101