SubtiBank SubtiBank
ywfM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywfM

unknown
locus
BSU_37630
pI
9.77
mw
31.19 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-91d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,862,357 3,863,247

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 15-138, aa 158-282) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A582 (ywfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/582 NBRP B. subtilis, Japan]
  • BKE37630 ([gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTCTCCCCTTTAA, downstream forward: _UP4_TAATAGATTCACATAAGCTT
  • BKK37630 ([gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTCTCCCCTTTAA, downstream forward: _UP4_TAATAGATTCACATAAGCTT
  • References

  • 20525796