SubtiBank SubtiBank
yfiY
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfiY

[SW|ABC transporter for the siderophore schizokinen and arthrobactin (binding protein), works with ATPase [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV]
locus
BSU_08440
pI
7.17
mw
36.15 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
function
[SW|acquisition of iron]
product
[SW|ABC transporter] for the siderophore schizokinen and arthrobactin (binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    919,366 920,343

    Phenotypes of a mutant

  • poor growth with the xenosiderophores arthrobactin or aerobactin as single source of iron [Pubmed|23220087]
  • The protein

    Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Fe/B12 periplasmic-binding domain] (aa 56-325) (according to UniProt)
  • Modification

  • phosphorylation on (Ser-290 OR Thr-302) [Pubmed|17218307]
  • Structure

  • [PDB|3TNY] (from B. cereus, 57% identity)
  • [SW|Localization]

  • associated to the membrane (via [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|YfhA]-[protein|81494D4E7E52531802C3C0D0073739DA9375F5DF|YfiZ]) [Pubmed|10092453,18763711]
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|521246EDA87A00F1B5E0792EC7AF1EF2B11C1C3C|yfiY]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • repressed unless the cells enter an iron starvation ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C311 (yfiY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2309 NBRP B. subtilis, Japan]
  • BKE08440 ([gene|521246EDA87A00F1B5E0792EC7AF1EF2B11C1C3C|yfiY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCCTCCCAATAT, downstream forward: _UP4_AAATAAAAAAAGACTCCGTC
  • BKK08440 ([gene|521246EDA87A00F1B5E0792EC7AF1EF2B11C1C3C|yfiY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCCTCCCAATAT, downstream forward: _UP4_AAATAAAAAAAGACTCCGTC
  • References

  • 10092453,16672620,12354229,18957862,18763711,17218307,23220087,23199363