SubtiBank SubtiBank
cysH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cysH

phosphoadenosine phosphosulfate sulfotransferase
locus
BSU15570
pI
5.46
mw
26.83 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
function
sulfate reduction
product
phosphoadenosine phosphosulfate sulfotransferase
essential
no
ec
1.8.4.8
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    1,630,382 1,631,083

    The protein

    Catalyzed reaction/ biological activity

  • Adenosine 3',5'-bisphosphate sulfite thioredoxin disulfide = 3'-phosphoadenylyl sulfate thioredoxin (according to Swiss-Prot)
  • Protein family

  • CysH subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|YitB]
  • Structure

  • [PDB|2GOY] (from ''Pseudomonas aeruginosa'', 35% identity) [Pubmed|17010373]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE15570 ([gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCTTTCCTCCTTT, downstream forward: _UP4_CTGCATGAATAAGGAGCTGC
  • BKK15570 ([gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCTTTCCTCCTTT, downstream forward: _UP4_CTGCATGAATAAGGAGCTGC
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 10094622,16267287,11004190,12107147,18039762,9006060,17010373,29794222