SubtiBank SubtiBank
cysH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cysH

phosphoadenosine phosphosulfate sulfotransferase
locus
BSU_15570
pI
5.46
mw
26.83 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
function
sulfate reduction
product
phosphoadenosine phosphosulfate sulfotransferase
essential
no
ec
1.8.4.8
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    1,630,382 1,631,083

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-disulfide + adenosine 3',5'-bisphosphate + 2 H+ + sulfite --> 3'-phosphoadenylyl sulfate + [thioredoxin]-dithiol (according to UniProt)
  • Protein family

  • PAPS reductase family (with [protein|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|YitB], according to UniProt)
  • Paralogous protein(s)

  • [protein|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|YitB]
  • Structure

  • [PDB|2GOY] (from ''Pseudomonas aeruginosa'', 35% identity) [Pubmed|17010373]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE15570 ([gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCTTTCCTCCTTT, downstream forward: _UP4_CTGCATGAATAAGGAGCTGC
  • BKK15570 ([gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCTTTCCTCCTTT, downstream forward: _UP4_CTGCATGAATAAGGAGCTGC
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 10094622,16267287,11004190,12107147,18039762,9006060,17010373,29794222