SubtiBank SubtiBank
thiC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiC

4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate (HMP-P) synthase, biosynthesis of the pyrimidine moiety of thiamine
locus
BSU08790
pI
5.26
mw
65.74 kDa
protein length
590 aa Sequence Blast
gene length
1773 bp Sequence Blast
function
biosynthesis of thiamine
product
4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate (HMP-P) synthase
essential
no
synonyms
thiA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    955,895 957,667

    The protein

    Protein family

  • thiC family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-556 [Pubmed|22517742]
  • phosphorylated on Ser-565, Ser-586 and Tyr-589 [Pubmed|20509597]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|3EPN] (from Caulobacter crescentus, 65% identity) [pubmed|18953358]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|12376536]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • 1A603 ( ''thiC''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A603&Search=1A603 BGSC]
  • BKE08790 ([gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTTCCTTCCCCTT, downstream forward: _UP4_TAAAAAAAATGAAGATGGAG
  • BKK08790 ([gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTTCCTTCCCCTT, downstream forward: _UP4_TAAAAAAAATGAAGATGGAG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 19348578,10382260
  • Original publications

  • 16291685,9370266,20509597,12376536,22517742,22383849,18953358,28516784,29794222