SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate (HMP-P) synthase, biosynthesis of the pyrimidine moiety of thiamine
65.74 kDa
protein length
590 aa Sequence Blast
gene length
1773 bp Sequence Blast
biosynthesis of thiamine
4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate (HMP-P) synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    955,895 957,667

    The protein

    Catalyzed reaction/ biological activity

  • 5-amino-1-(5-phospho-β-D-ribosyl)imidazole + S-adenosyl-L-methionine --> 4-amino-2-methyl-5-(phosphooxymethyl)pyrimidine + 5'-deoxyadenosine + CO + formate + 3 H+ + L-methionine (according to UniProt)
  • Protein family

  • thiC family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-556 [Pubmed|22517742]
  • phosphorylated on Ser-565, Ser-586 and Tyr-589 [Pubmed|20509597]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|3EPN] (from Caulobacter crescentus, 65% identity) [pubmed|18953358]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|12376536]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • 1A603 ( ''thiC''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE08790 ([gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTTCCTTCCCCTT, downstream forward: _UP4_TAAAAAAAATGAAGATGGAG
  • BKK08790 ([gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTTCCTTCCCCTT, downstream forward: _UP4_TAAAAAAAATGAAGATGGAG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 19348578,10382260
  • Original publications

  • 16291685,9370266,20509597,12376536,22517742,22383849,18953358,28516784,29794222