SubtiBank SubtiBank
hemQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hemQ

coproheme decarboxylase
locus
BSU37670
pI
4.97
mw
29.35 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
biosynthesis of heme
product
coproheme decarboxylase
essential
no
ec
1.11.1.-
synonyms
ipa-87r,ywfI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,866,596 3,867,360

    Phenotypes of a mutant

  • defect in heme biosynthesis
  • The protein

    Catalyzed reaction/ biological activity

  • coproheme --> protoheme + 2 CO2 + 4 H+ [pubmed|25646457]
  • Protein family

  • UPF0447 family (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-41 [Pubmed|17218307]
  • [SW|Cofactors]

  • heme
  • Structure

  • [PDB|5T2K] (''Geobacillus stearothermophilus'') [pubmed|27936663]
  • Expression and Regulation

    Operons

    genes
    [gene|51B3ED39FC423164A6FD6271815E029137B362A9|hemQ]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A516 (ywfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/516 NBRP B. subtilis, Japan]
  • BKK37670 ([gene|51B3ED39FC423164A6FD6271815E029137B362A9|hemQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTTCACTCCCATT, downstream forward: _UP4_TAATATCCCCTCCCGCCCTA
  • Expression vectors

  • pGP2643: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • pGP2644: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • pGP2637: N-terminal Strep-tag, in [SW|pGP380], for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 28123057,25711532
  • Original Publications

  • 17218307,9353933,20543190,25646457,27758026,27982566,27599156,27936663,26083961,27597779