SubtiBank SubtiBank
hemQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hemQ

coproheme decarboxylase
locus
BSU_37670
pI
4.97
mw
29.35 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
biosynthesis of heme
product
coproheme decarboxylase
essential
no
ec
1.11.1.-
synonyms
ipa-87r,ywfI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,866,596 3,867,360

    Phenotypes of a mutant

  • defect in heme biosynthesis
  • The protein

    Catalyzed reaction/ biological activity

  • coproheme --> protoheme + 2 CO2 + 4 H+ [pubmed|25646457]
  • Protein family

  • UPF0447 family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-41 [Pubmed|17218307]
  • [SW|Cofactors]

  • heme
  • Structure

  • [PDB|5T2K] (''Geobacillus stearothermophilus'') [pubmed|27936663]
  • Expression and Regulation

    Operons

    genes
    [gene|51B3ED39FC423164A6FD6271815E029137B362A9|hemQ]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A516 (ywfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/516 NBRP B. subtilis, Japan]
  • BKK37670 ([gene|51B3ED39FC423164A6FD6271815E029137B362A9|hemQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTTCACTCCCATT, downstream forward: _UP4_TAATATCCCCTCCCGCCCTA
  • Expression vectors

  • pGP2643: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • pGP2644: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • pGP2637: N-terminal Strep-tag, in [SW|pGP380], for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 28123057,25711532
  • Original Publications

  • 17218307,9353933,20543190,25646457,27758026,27982566,27599156,27936663,26083961,27597779