SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|MarR family|MarR/DUF24 family] transcription regulator
15.07 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
[SW|MarR family|MarR/DUF24 family] transcription regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    575,712 576,098

    The protein

    Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR], [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF], [protein|1E74F0557FF9ECB404B6544831F4E0A162473423|YtcD]
  • [SW|Domains]

  • [SW|HTH hxlR-type domain] (aa 18-116) (according to UniProt)
  • Structure

  • [PDB|4A5M] ([protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], 71% identity) [pubmed|22238377]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C167 (ydeP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05290 ([gene|51B1913B59C1876CCED4A88414797B3A22BE4E3C|ydeP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTGTTCACTCCTAATA, downstream forward: _UP4_TAATAACCAGAAAAAATACC
  • BKK05290 ([gene|51B1913B59C1876CCED4A88414797B3A22BE4E3C|ydeP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTGTTCACTCCTAATA, downstream forward: _UP4_TAATAACCAGAAAAAATACC
  • References

    Research papers

  • 22238377