SubtiBank SubtiBank
cpgA

cpgA

ribosome assembly GTPase, activity stimulated by ribosomes, may be involved in the maturation of the 30S subunit of the ribosome, detoxification of 4-phosphoerythronate
locus
BSU_15780
pI
4.74
mw
33.64 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
function
ribosome assembly, coordination of peptidoglycan deposition in the cell wall, metabolite proofreading
product
GTPase
essential
no
synonyms
yloQ,rsgA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    1,653,103 1,653,999

    Phenotypes of a mutant

  • forms curly cells [Pubmed|22544754]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of 4-phosphoerythronate thus preventing inhibition of [protein|61B7C51EB7E74226890010B61D8E41C02189A453|GndA] [pubmed|30948730]
  • Protein family

  • TRAFAC class YlqF/YawG GTPase family (together with [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] and [protein|959C0ED7B9DA50F0EADCF1565405B878D36DA206|YqeH], according to UniProt)
  • [SW|Domains]

  • CP-type G domain (aa 67-228) (according to UniProt)
  • Modification

  • ''in vitro'' phosphorylated on Thr-166 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC] [Pubmed|22544754,19246764]
  • Structure

  • [PDB|1T9H]
  • Expression and Regulation

    Operons

    genes
    [gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]-[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]-[gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]-[gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]-[gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]
    description
    [Pubmed|16025310]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B135 (yloQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1134 NBRP B. subtilis, Japan]
  • BKE15780 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAGGCATATTTTCCCTCC, downstream forward: _UP4_GACAGAAAGCCGAGGTATTA
  • BKK15780 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAGGCATATTTTCCCTCC, downstream forward: _UP4_GACAGAAAGCCGAGGTATTA
  • labs

  • [SW|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html homepage]
  • References

    Reviews

  • 19575570
  • Original publications

  • 15223319,16485133,14747714,22544754,18344364,19246764,19246764,15828870,17005971,18344364,18984160,28189581,30948730