SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


ribosome assembly GTPase, activity stimulated by ribosomes, may be involved in the maturation of the 30S subunit of the ribosome, detoxification of 4-phosphoerythronate
33.64 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
ribosome assembly, coordination of peptidoglycan deposition in the cell wall, metabolite proofreading

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    1,653,103 1,653,999

    Phenotypes of a mutant

  • forms curly cells [Pubmed|22544754]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of 4-phosphoerythronate thus preventing inhibition of [protein|61B7C51EB7E74226890010B61D8E41C02189A453|GndA] [pubmed|30948730]
  • Protein family

  • TRAFAC class YlqF/YawG GTPase family (together with [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] and [protein|959C0ED7B9DA50F0EADCF1565405B878D36DA206|YqeH], according to UniProt)
  • Modification

  • ''in vitro'' phosphorylated on Thr-166 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC] [Pubmed|22544754,19246764]
  • Structure

  • [PDB|1T9H]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B135 (yloQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15780 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAGGCATATTTTCCCTCC, downstream forward: _UP4_GACAGAAAGCCGAGGTATTA
  • BKK15780 ([gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAGGCATATTTTCCCTCC, downstream forward: _UP4_GACAGAAAGCCGAGGTATTA
  • labs

  • [SW|Tony Wilkinson], York University, U.K. [ homepage]
  • References


  • 19575570
  • Original publications

  • 15223319,16485133,14747714,22544754,18344364,19246764,19246764,15828870,17005971,18344364,18984160,28189581,30948730