SubtiBank SubtiBank
feuA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

feuA

[SW|ABC transporter]for the siderophores Fe-enterobactin and Fe-bacillibactin (binding protein), with [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV] as ATPase
locus
BSU01630
pI
8.02
mw
34.95 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
function
[SW|acquisition of iron]
product
[SW|ABC transporter] for the siderophores Fe-enterobactin and Fe-bacillibactin (binding protein) [pubmed|28283524]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    182,370 183,323

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • [SW|Domains]

  • Two independent non-symmetric globular domains, connected by a long alpha-helix (residues 143-164 of the mature protein).
  • Modification

  • FeuA is a lipoprotein with a N-acetyl-S-diacyl-glyceryl-cysteine structure [Pubmed|22303020]
  • Structure

  • [PDB|2PHZ], [PDB|2WI8], [PDB|2WHY] (complex with ferri-bacillibactin)
  • [PDB|2XUZ] (complex with ferri-enterobactin)
  • [PDB|2XV1] (complex with ferric mecam)
  • [SW|Localization]

  • associated to the membrane (lipoprotein) [Pubmed|22303020]
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|EB28A65CECE994DF2DF486DEACF40F2533703DB0|Btr]: activation, in the presence of the co-activators bacillibactin or enterobactin [Pubmed|17725565], in [regulon|EB28A65CECE994DF2DF486DEACF40F2533703DB0|Btr regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393]
  • additional information

  • the presence of an iron-responsive element bound by [SW|CitB] between ''[SW|feuA]'' and ''[SW|feuB]'' suggests iron-dependent regulation by [SW|CitB] [Pubmed|10468622]
  • view in new tab

    Other regulations

  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: translation control,
  • Biological materials

    Mutant

  • BKE01630 ([gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATAGAGCCTCCTGTT, downstream forward: _UP4_AACTAATTCAGAGTAGGTTT
  • BKK01630 ([gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATAGAGCCTCCTGTT, downstream forward: _UP4_AACTAATTCAGAGTAGGTTT
  • References

  • 20086155,19746494,19673474,14563870,16672620,10092453,16889643,17725565,12354229,18957862,18763711,22303020,10468622,28283524,29133393