The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
osmo-sensing two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], part of the [SW|phosphorelay], checkpoint protein that links [SW|sporulation] initiation to [SW|biofilm formation]
function
initiation of [SW|sporulation]
product
two-component sensor kinase
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.1|The kinases][category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation][category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation][category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.1|The kinases][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]Gene
Coordinates
1,431,486 1,433,006
Phenotypes of a mutant
deletion of ''kinD'' suppresses the [SW|sporulation] defect of matrix mutants, while its overproduction delays [SW|sporulation] [Pubmed|20689749]inactivation of ''[gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], regulates the onset of sporulation by inhibiting the activity of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] until matrix, or a component therein, is sensed [http://mbio.asm.org/content/1/1/e00035-10.full PubMed]dual role as a [SW|phosphatase] or a [SW|kinase], activity is linked to the presence of extracellular matrix in the biofilms [Pubmed|20689749]mainly active in the younger, outer regions of a colony (with [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]) [Pubmed|21097618]ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)[SW|Domains]
two transmembrane segments, between them the extracellular pyruvate-binding sensing domain that consists of tandem PAS-like domains [Pubmed|23436677,22716461]see [Pubmed|22716461] for a scheme of the domain organization[SW|Histidine kinase domain] (aa 298-505) (according to UniProt)Modification
autophosphorylation on a His residueEffectors of protein activity
activity is stimulated by direct or indirect interaction with [protein|4DAB7847EA3848A34432C80124464543FA3DCA0F|Med] [Pubmed|21622736]L-malate seems to trigger KinD activity [Pubmed|22716461], but this effect may be indirect due to the excretion of pyruvate that directly binds the extracytoplasmic sensing domain of KinD [Pubmed|23436677]kinase activity is triggered and phosphatase activity is decreased by increased osmotic pressure [Pubmed|22882172]activity is triggered in the presence of glycerol + manganese [Pubmed|23564171]Structure
[PDB|4DBJ] (extracytoplasmic sensing domain) [Pubmed|23436677][SW|Localization]
cell membrane (according to UniProt)Expression and Regulation
Operons
genes
[gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]
description
[pubmed|22383849]
view in new tabBiological materials
Mutant
MGNA-B323 (ykvD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1322 NBRP B. subtilis, Japan]BKE13660 ([gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACCTGATTAGAGGTA, downstream forward: _UP4_TAGCCCCCCTGACCATGTCABKK13660 ([gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACCTGATTAGAGGTA, downstream forward: _UP4_TAGCCCCCCTGACCATGTCAReferences
10094672,11069677,20689749,26297017,21097618,22074846,22716461,22882172,23436677,23564171,21622736,22211522