SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional repressor of sporulation and degradative enzyme genes
23.96 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
regulation of sporulation, degradative enzyme and motility genes
transcriptional repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,304,096 3,304,719

    The protein

    Protein family

  • paiB family (single member, according to UniProt)
  • Structure

  • [PDB|2OL5] (from Geobacillus stearothermophilus, 39% identity) [pubmed|21633969]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A088 (paiB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32140 ([gene|511CFC625D79AAA8B78809651684E4E409337AFA|paiB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCCACCCTTCGA, downstream forward: _UP4_TAAGCTTACTTTGCTGAAGA
  • BKK32140 ([gene|511CFC625D79AAA8B78809651684E4E409337AFA|paiB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCCACCCTTCGA, downstream forward: _UP4_TAAGCTTACTTTGCTGAAGA
  • References

  • 2108124,27965289,21633969