SubtiBank SubtiBank
nadR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nadR

transcriptional repressor of genes involved in NAD biosynthesis
locus
BSU_27890
pI
5.76
mw
19.58 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
regulation of NAD biosynthesis
product
transcriptional repressor
essential
no
synonyms
yrxA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,850,716 2,851,258

    The protein

    Structure

  • [PDB|1J5Y] (from Thermotoga maritima, 38% identity) [pubmed|17256761]
  • Expression and Regulation

    Operons

    genes
    [gene|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS]-[gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]
    description
    [Pubmed|8444804]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|8444804,16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|8444804,16199587]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A824 (yrxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/824 NBRP B. subtilis, Japan]
  • BKE27890 ([gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • BKK27890 ([gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]
  • References

  • 18276644,8444804,16199587,17256761