SubtiBank SubtiBank
xlyA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xlyA

N-acetylmuramoyl-L-alanine amidase, required for the formation of membrane vesicles in a sub-population of cells
locus
BSU_12810
pI
5.34
mw
31.76 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
PBSX prophage-mediated lysis
product
N-acetylmuramoyl-L-alanine amidase
essential
no
ec
3.5.1.28
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,347,289 1,348,182

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB], [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH]
  • [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] [Pubmed|18430080]
  • contains an amidase_2 domain (like [protein|C1EB8D05386C1B35B8002239F5247CC6AB25F786|BlyA], [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB])
  • [SW|N-acetylmuramoyl-L-alanine amidase domain] (aa 45-140) (according to UniProt)
  • [SW|LysM domain] (aa 159-203) (according to UniProt)
  • Structure

  • [PDB|3HMA] [Pubmed|21816821]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]-[gene|0BF8AD1ACD0BBA6913636081B41E6D04D16D1BA2|xkdN]-[gene|156A8B699B32B268EBA1A0A1620C95D0DF630A4E|xkzB]-[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]-[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]-[gene|D5FDCC792D0E6B8D35BCDDC0D7B76025ACC900FF|xkdQ]-[gene|AF9706F2EBF056A404B5D7640D78D1E833805225|xkdR]-[gene|C222F247C225FD6DEBB103DFB169AEF87DFC0C0D|xkdS]-[gene|1234C9BC164FB47E003009E943124982260221C0|xkdT]-[gene|BDE032590D5F3504CDB4D6BD545153D681B65ADD|xkdU]-[gene|3BCF7587145CFEDEA2F36512ABF62D6B6A2886C5|xkzA]-[gene|9FAAA2E63B161862396C47CE5D1EA9191847FDAD|xkdV]-[gene|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|xkdW]-[gene|787561F433911D090F801AD493F688895498542F|xkdX]-[gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]-[gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
    description
    [Pubmed|22383849,2110147]

    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE12810 ([gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTCTCCTTATT, downstream forward: _UP4_TGATCAAAGACCATAAAAAT
  • BKK12810 ([gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTCTCCTTATT, downstream forward: _UP4_TGATCAAAGACCATAAAAAT
  • References

    Reviews

  • 18430080
  • Original publications

  • 9555893,21816821,7921239,18957862,28883390