SubtiBank SubtiBank
yukE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yukE

secreted protein of the WXG100 superfamily, homolog of virulence factor EsxA
locus
BSU_31910
pI
7.91
mw
9.00 kDa
protein length
gene length
294 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,276,141 3,276,434

    The protein

    Protein family

  • WXG100 family (with [protein|A177DF098115F85F23A1D42EFB07D294B515830F|YfjA], according to UniProt) (pfam06013) [Pubmed|11973144]
  • Structure

  • [PDB|3ZBH] (from Geobacillus thermodenitrificans, 59% identity)
  • [SW|Localization]

  • secreted, by the type VII [SW|protein secretion] system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|YukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|YukC]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|YukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|YueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|YueC] [Pubmed|24828531,23861817]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|yukC]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|23861817], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|23861817]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A628 (yukE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/628 NBRP B. subtilis, Japan]
  • BKE31910 ([gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCTCATTACCTCCT, downstream forward: _UP4_TAACAGTATGAAAGGGAAGG
  • BKK31910 ([gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCTCATTACCTCCT, downstream forward: _UP4_TAACAGTATGAAAGGGAAGG
  • References

  • 15576783,22383849,11973144,23861817,23861817,15378759,24798022,24696501,21395229,24828531