SubtiBank SubtiBank
yukE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yukE

secreted protein of the WXG100 superfamily, homolog of virulence factor EsxA
locus
BSU31910
pI
7.91
mw
9.00 kDa
protein length
gene length
294 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,276,141 3,276,434

    The protein

    Protein family

  • WXG100 superfamily (pfam06013) [Pubmed|11973144]
  • Structure

  • [PDB|3ZBH] (from Geobacillus thermodenitrificans, 59% identity)
  • [SW|Localization]

  • secreted, by the type VII [SW|protein secretion] system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|YukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|YukC]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|YukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|YueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|YueC] [Pubmed|24828531,23861817]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|yukC]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|23861817], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|23861817]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A628 (yukE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/628 NBRP B. subtilis, Japan]
  • BKE31910 ([gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCTCATTACCTCCT, downstream forward: _UP4_TAACAGTATGAAAGGGAAGG
  • BKK31910 ([gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCTCATTACCTCCT, downstream forward: _UP4_TAACAGTATGAAAGGGAAGG
  • References

  • 15576783,22383849,11973144,23861817,23861817,15378759,24798022,24696501,21395229,24828531