SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


pleiotropic regulator of sulfur metabolism
11.75 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
regulation of sulfur metabolism
transcription repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    2,811,717 2,812,133

    Phenotypes of a mutant

  • impaired growth in the presence of cystine and increased sensitivity to hydrogen peroxide-, disulfide-, paraquat- and tellurite-induced stresses [Pubmed|20608979]
  • increased intracellular cysteine pool and hydrogen sulfide formation [Pubmed|20608979]
  • depletion of branched-chain amino acids [Pubmed|20608979]
  • The protein

    Protein family

  • Rrf2 family of transcription regulators
  • [SW|Domains]

  • [SW|HTH rrf2-type domain] (aa 2-125) (according to UniProt)
  • [SW|Cofactors]

  • [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK] acts as corepressor [Pubmed|18974048]
  • Structure

  • [PDB|2Y75] [Pubmed|21624051]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16885442], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • MGNA-B515 (yrzC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27520 ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATGAACACCTCTGTTA, downstream forward: _UP4_ATTTAGATCAGAGGTGTAAA
  • BKK27520 ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATGAACACCTCTGTTA, downstream forward: _UP4_ATTTAGATCAGAGGTGTAAA
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

    The [SW|CymR regulon]

  • 16513748
  • Other original publications

  • 18974048,17056751,16109943,16885442,11948165,15668000,20608979,21624051