SubtiBank SubtiBank
cymR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cymR

pleiotropic regulator of sulfur metabolism
locus
BSU27520
pI
9.88
mw
11.75 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
function
regulation of sulfur metabolism
product
transcription repressor
essential
no
synonyms
yrzC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    2,811,717 2,812,133

    Phenotypes of a mutant

  • impaired growth in the presence of cystine and increased sensitivity to hydrogen peroxide-, disulfide-, paraquat- and tellurite-induced stresses [Pubmed|20608979]
  • increased intracellular cysteine pool and hydrogen sulfide formation [Pubmed|20608979]
  • depletion of branched-chain amino acids [Pubmed|20608979]
  • The protein

    Protein family

  • Rrf2 family of transcription regulators
  • [SW|Cofactors]

  • [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK] acts as corepressor [Pubmed|18974048]
  • Structure

  • [PDB|2Y75] [Pubmed|21624051]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000198 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]-[gene|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|yrvO]-[gene|2F5DFBE980FFF5810B76BCFCD189BA0F6C415B4F|trmU]-[gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]-[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]-[gene|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|yrvO]-[gene|2F5DFBE980FFF5810B76BCFCD189BA0F6C415B4F|trmU]
    description
    [Pubmed|16885442]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16885442], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B515 (yrzC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1514 NBRP B. subtilis, Japan]
  • BKE27520 ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATGAACACCTCTGTTA, downstream forward: _UP4_ATTTAGATCAGAGGTGTAAA
  • BKK27520 ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATGAACACCTCTGTTA, downstream forward: _UP4_ATTTAGATCAGAGGTGTAAA
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

    The [SW|CymR regulon]

  • 16513748
  • Other original publications

  • 18974048,17056751,16109943,16885442,11948165,15668000,20608979,21624051