SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pleiotropic regulator of sulfur metabolism
11.75 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
regulation of sulfur metabolism
transcription repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    2,811,717 2,812,133

    Phenotypes of a mutant

  • impaired growth in the presence of cystine and increased sensitivity to hydrogen peroxide-, disulfide-, paraquat- and tellurite-induced stresses [Pubmed|20608979]
  • increased intracellular cysteine pool and hydrogen sulfide formation [Pubmed|20608979]
  • depletion of branched-chain amino acids [Pubmed|20608979]
  • The protein

    Protein family

  • Rrf2 family of transcription regulators
  • [SW|Domains]

  • [SW|HTH rrf2-type domain] (aa 2-125) (according to UniProt)
  • [SW|Cofactors]

  • [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK] acts as corepressor [Pubmed|18974048]
  • Structure

  • [PDB|2Y75] [Pubmed|21624051]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16885442], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • MGNA-B515 (yrzC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27520 ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATGAACACCTCTGTTA, downstream forward: _UP4_ATTTAGATCAGAGGTGTAAA
  • BKK27520 ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACATGAACACCTCTGTTA, downstream forward: _UP4_ATTTAGATCAGAGGTGTAAA
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

    The [SW|CymR regulon]

  • 16513748
  • Other original publications

  • 18974048,17056751,16109943,16885442,11948165,15668000,20608979,21624051