SubtiBank SubtiBank
yrrK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrrK

processing of the 5 end of pre-16S rRNA (based on similarity to E. coli YqgF)
locus
BSU_27390
pI
5.32
mw
15.07 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
function
16S rRNA maturation
product
putative RNase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    2,797,399 2,797,815

    The protein

    Protein family

  • YqgF nuclease family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|YqgF/RNase H-like domain] (aa 1 ... 103) (according to the Interpro database)
  • Structure

  • [PDB|1VHX] [Pubmed|16021622]
  • Expression and Regulation

    Operons

    genes
    [gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|yrzL]-[gene|508FC7117B4CE7AF119B3830AE9DC113CB058039|yrrK]-[gene|A0AA5289F5E92A4B2E18E4F3439F2D412208826E|yrzB]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|8C5C7F9A585AE89D53EAF1DB3A9AB525B9E30B4A|alaS]-[gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|yrzL]-[gene|508FC7117B4CE7AF119B3830AE9DC113CB058039|yrrK]-[gene|A0AA5289F5E92A4B2E18E4F3439F2D412208826E|yrzB]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|T-box|T-box]: antitermination, in [regulon|T-box|T-box]
  • regulation

  • induced by alanine limitation ([regulon|T-box|T-box]) [Pubmed|19258532]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B514 (yrrK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1513 NBRP B. subtilis, Japan]
  • BKE27390 ([gene|508FC7117B4CE7AF119B3830AE9DC113CB058039|yrrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTCCTAATATTCTCATTC, downstream forward: _UP4_AATTAAAGCCAGAGGTGAAG
  • BKK27390 ([gene|508FC7117B4CE7AF119B3830AE9DC113CB058039|yrrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTCCTAATATTCTCATTC, downstream forward: _UP4_AATTAAAGCCAGAGGTGAAG
  • References

  • 25545592,27527105,16021622