SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


33.69 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    241,917 242,837

    The protein

    Protein family

  • [SW|eamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2[SW|EamA domain]s (aa 18-141, aa 162-291) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B969 (ybfH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02210 ([gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCGAAGTTTCTCTTTGTA, downstream forward: _UP4_TAACGGCATCCATTTTTTTA
  • BKK02210 ([gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCGAAGTTTCTCTTTGTA, downstream forward: _UP4_TAACGGCATCCATTTTTTTA