SubtiBank SubtiBank
ybfH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfH

unknown
locus
BSU_02210
pI
8.36
mw
33.69 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    241,917 242,837

    The protein

    Protein family

  • [SW|eamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2[SW|EamA domain]s (aa 18-141, aa 162-291) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]-[gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B969 (ybfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1968 NBRP B. subtilis, Japan]
  • BKE02210 ([gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCGAAGTTTCTCTTTGTA, downstream forward: _UP4_TAACGGCATCCATTTTTTTA
  • BKK02210 ([gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCGAAGTTTCTCTTTGTA, downstream forward: _UP4_TAACGGCATCCATTTTTTTA