SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional regulator ([SW|MerR family]) of the [gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]-[gene|34360353D4488F1081FEF9A3CF8F1866D271657D|bltD] operon
32.02 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
regulation of spermidine efflux and degradation
transcriptional regulator ([SW|MerR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Metabolism of polyamines]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,716,035 2,716,856

    The protein

    Protein family

  • [SW|MerR family]
  • Biological materials


  • MGNA-C434 (bltR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26580 ([gene|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|bltR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCTCCTTGACTA, downstream forward: _UP4_TAAAATTACGAGATTTTCAT
  • BKK26580 ([gene|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|bltR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCTCCTTGACTA, downstream forward: _UP4_TAAAATTACGAGATTTTCAT
  • References

  • 7608059