SubtiBank SubtiBank
yisQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisQ

probable multidrug resistance protein
locus
BSU_10820
pI
10.18
mw
49.85 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
function
unknown
product
putative multidrug exporter
essential
no
synonyms
yucE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.15|Multidrug exporters/ based on homology]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,160,776 1,162,143

    The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (accordinig to UniProt)
  • Structure

  • [PDB|3VVO] (MATE multidrug exporter from Pyrococcus furiosus, 23% identity) [pubmed|23535598]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5050D0049B87C9FF2ACCE45BD13FDA0227AAB804|yisQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B182 (yisQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1181 NBRP B. subtilis, Japan]
  • BKE10820 ([gene|5050D0049B87C9FF2ACCE45BD13FDA0227AAB804|yisQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGTCTAACCCCTTTC, downstream forward: _UP4_TAACACCCGGCTCAATCAAG
  • BKK10820 ([gene|5050D0049B87C9FF2ACCE45BD13FDA0227AAB804|yisQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGTCTAACCCCTTTC, downstream forward: _UP4_TAACACCCGGCTCAATCAAG
  • References

    Research papers

  • 23535598