SubtiBank SubtiBank
yhfT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfT

similar to long-chain fatty-acid-CoA ligase, involved in surfactin production
locus
BSU_10360
pI
5.95
mw
52.71 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,110,479 1,111,918

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|YngI], [protein|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|LcfA], [protein|41B879EF69E2D4F5C1896A4709567B88FD8AC5B7|LcfB]
  • Structure

  • [PDB|5BUQ] ([protein|16412BAB04BBF9FD1C3653328923687874C81868|MenE], 29% identitiy) [Pubmed|26276389]
  • Expression and Regulation

    Operons

    genes
    [gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]-[gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|11717296], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|11717296]
  • additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    genes
    [gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B280 (yhfT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1279 NBRP B. subtilis, Japan]
  • available in [SW|Mohamed Marahiel]'s lab [Pubmed|20797616]
  • BKE10360 ([gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTATGAGTAATTGTCATGT, downstream forward: _UP4_CTGGAAGAGAGTGTACAGTA
  • BKK10360 ([gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTATGAGTAATTGTCATGT, downstream forward: _UP4_CTGGAAGAGAGTGTACAGTA
  • References

  • 20797616,22383849,12368242