SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphoserine phosphatase, catalyzes the last step in serine biosynthesis
29.36 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
biosynthesis of serine
phosphoserine phoshatase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • Gene

    2,958,434 2,959,216

    Phenotypes of a mutant

  • auxotrophic for serine [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphoserine - serine + phosphate [Pubmed|28189581]
  • Protein family

  • [SW|HAD superfamily]
  • Paralogous protein(s)

  • [protein|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|YfnB]
  • Structure

  • [PDB|2GFH] (from mouse, 32% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A998 [gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::erm, available at the [ NBRP B. subtilis, Japan]
  • BKE28940 ([gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCTCCTCTGCTT, downstream forward: _UP4_TAAAAAAAGCATGATCTCTT
  • BKK28940 ([gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCTCCTCTGCTT, downstream forward: _UP4_TAAAAAAAGCATGATCTCTT
  • References

  • 8969504,27784292,28189581