SubtiBank SubtiBank
serB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

serB

phosphoserine phosphatase, catalyzes the last step in serine biosynthesis
locus
BSU_28940
pI
4.67
mw
29.36 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
function
biosynthesis of serine
product
phosphoserine phoshatase
essential
no
synonyms
ysaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • Gene

    Coordinates
    2,958,434 2,959,216

    Phenotypes of a mutant

  • auxotrophic for serine [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphoserine - serine + phosphate [Pubmed|28189581]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|YfnB]
  • Structure

  • [PDB|2GFH] (from mouse, 32% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]
    description
    [pubmed|22383849,8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A998 [gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::erm, available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/998 NBRP B. subtilis, Japan]
  • BKE28940 ([gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCTCCTCTGCTT, downstream forward: _UP4_TAAAAAAAGCATGATCTCTT
  • BKK28940 ([gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCTCCTCTGCTT, downstream forward: _UP4_TAAAAAAAGCATGATCTCTT
  • References

  • 8969504,27784292,28189581