SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


fructose-1-phosphate kinase
32.64 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
fructose utilization
fructose-1-phosphate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of fructose]
  • Gene

    1,508,330 1,509,241

    The protein

    Catalyzed reaction/ biological activity

  • ATP + β-D-fructose 1-phosphate --> ADP + β-D-fructose 1,6-bisphosphate + H+ (according to UniProt)
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|3OHR]
  • Expression and Regulation



    regulatory mechanism

  • [protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]: repression, (according to [ DBTBS]), in [regulon|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR regulon]
  • regulation

  • induced in the presence of fructose ([protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]) (according to [ DBTBS])
  • view in new tab

    Biological materials


  • BKE14390 ([gene|502AA809C8C95F8886DD91FBB7DDBECC63342327|fruK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGATTAAGTGTTACAGTGT, downstream forward: _UP4_CGTCTATAGAGGAGGAAACA
  • BKK14390 ([gene|502AA809C8C95F8886DD91FBB7DDBECC63342327|fruK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGATTAAGTGTTACAGTGT, downstream forward: _UP4_CGTCTATAGAGGAGGAAACA
  • References

  • 10627040,23033921