SubtiBank SubtiBank
ykkD [2018-10-10 18:41:12]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykkD [2018-10-10 18:41:12]

putative guanidine exporter
locus
BSU13100
pI
8.62
mw
11.19 kDa
protein length
105 aa Sequence Blast
gene length
315 bp Sequence Blast
function
export/ detoxification of guanidine
product
subunit of guanidine exporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,376,855 → 1,377,172

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • Structure

  • [PDB|3B5D] (29% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]-[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]
    description
    [Pubmed|10735877]

    regulatory mechanism

  • [protein|E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch]: antitermination, [pubmed|28060483,27989440], in [regulon|E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch regulon]
  • regulation

  • induced in the presence of guanidine ([SW|ykkC riboswitch]) [Pubmed|27989440]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A748 (ykkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/748 NBRP B. subtilis, Japan]
  • BKE13100 (Δ[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAACTGATCCAGTGCA, downstream forward: _UP4_TAAATTGATTTTTATCAAAT
  • BKK13100 (Δ[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAACTGATCCAGTGCA, downstream forward: _UP4_TAAATTGATTTTTATCAAAT
  • References

    Reviews

  • 17942072
  • Original publications

  • 10735877,21317561,27989440,27120414